Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG05808a.1 | CBG05808a.1 | [unknown] | |
Transcript:CBG05808b.1 | CBG05808b.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CBG05808a | CBG05808a | [unknown] | |
CDS:CBG05808b | CBG05808b | [unknown] |
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_downregulated | |
C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_upregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG26357, AATGGACTTGAAGATCGTCATCGCAACATCTCAACTGCAAGTGTAGGAGACAGTGAGTTT, WBGene00087771 | Expr1061155 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
Cbr-kcc-1, ATACCAACTTCGTATCGACGCCAAAATCATGATTGTCGAGTTGGCAGATCCAGAAATCTC, WBGene00028190 | Expr1052598 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |