WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028263 Gene Name  Cbr-pam-1
Sequence Name  ? CBG05905 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable metallopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans pam-1. In C. elegans, pam-1 is involved in several processes, including exit from meiosis; first cell cycle pseudocleavage; and regulation of reproductive process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05905b.1 CBG05905b.1   [unknown]
Transcript:CBG05905a.1 CBG05905a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05905a CBG05905a   [unknown]
CDS:CBG05905b CBG05905b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_downregulated
  C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-pam-1, CCGTCTTCTCGAATCCAATCGCTCAGTGATCGAGACTCTTCTCAAACAAAGCAACTTATA, WBGene00028263   Expr1068477 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  involved_in

0 Homologues

0 Locations

3 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region