WormMine: Gene WBGene00028294

• WormBase Gene ID: WBGene00028294
• Gene Name: Cbr-itr-1
• Sequence Name: CBG05938
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable inositol 1,4,5 trisphosphate binding activity and inositol 1,4,5-trisphosphate-gated calcium channel activity. Predicted to be involved in calcium ion transmembrane transport. Predicted to be located in endoplasmic reticulum and membrane. Is an ortholog of C. elegans itr-1. In C. elegans, itr-1 is involved in several processes, including determination of adult lifespan; mating behavior; and system process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05938a.1	CBG05938a.1		[unknown]
Transcript:CBG05938b.1	CBG05938b.1		[unknown]
Transcript:CBG05938c.1	CBG05938c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05938c	CBG05938c		[unknown]
CDS:CBG05938a	CBG05938a		[unknown]
CDS:CBG05938b	CBG05938b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050563
• Remark: Cbr-itr-1, GCTCAATGTGTGAAGGAGCGAAATTTGGATTGGTTCCCAAGAATGCAAGCTCTATCCCTT, WBGene00028294
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

10 GO Annotation

0 Homologues

0 Locations

10 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region