WormMine: Gene WBGene00028358

• WormBase Gene ID: WBGene00028358
• Gene Name: CBG06012
• Sequence Name: CBG06012
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans clc-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06012a.1	CBG06012a.1		[unknown]
Transcript:CBG06012b.1	CBG06012b.1		[unknown]
Transcript:CBG06012c.1	CBG06012c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06012a	CBG06012a		[unknown]
CDS:CBG06012b	CBG06012b		[unknown]
CDS:CBG06012c	CBG06012c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052988
• Remark: CBG06012, CTTCAATGGATTTCATTTGTTTGCAGTTTGTTTGGATCTGCACTTGTGCTAGTTCATAAA, WBGene00028358
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region