WormMine: Gene WBGene00028443

• WormBase Gene ID: WBGene00028443
• Gene Name: CBG06114
• Sequence Name: CBG06114
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable lysozyme activity. Predicted to be involved in cell wall macromolecule catabolic process and peptidoglycan catabolic process. Is an ortholog of C. elegans lys-5. In C. elegans, lys-5 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06114.1	CBG06114.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06114	CBG06114		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1050549
• Remark: Cbr-lys-6.2, ACTATTCATCAGTGGGAGGAAATAACCTCAAAAGGTCCATGTGGTATCAGTGGTGTTGAT, WBGene00028443
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region