WormMine: Gene WBGene00028489

• WormBase Gene ID: WBGene00028489
• Gene Name: Cbr-let-92
• Sequence Name: CBG06179
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable hydrolase activity. Is an ortholog of C. elegans let-92. In C. elegans, let-92 is involved in microtubule cytoskeleton organization and nuclear envelope organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06179.1	CBG06179.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06179	CBG06179		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058146
• Remark: Cbr-let-92, CGGGTTCTATGACGAGTGCTTGAGAAAGTACGGAAACTCAAACGTGTGGAAGTATTTTAC, WBGene00028489
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region