WormMine: Gene WBGene00028512

• WormBase Gene ID: WBGene00028512
• Gene Name: Cbr-unc-22
• Sequence Name: CBG06205
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans unc-22. In C. elegans, unc-22 is involved in several processes, including adult behavior; positive regulation of sarcomere organization; and positive regulation of striated muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06205a.1	CBG06205a.1		[unknown]
Transcript:CBG06205b.1	CBG06205b.1		[unknown]
Transcript:CBG06205d.1	CBG06205d.1		[unknown]
Transcript:CBG06205c.1	CBG06205c.1		[unknown]
Transcript:CBG06205e.1	CBG06205e.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06205e	CBG06205e		[unknown]
CDS:CBG06205b	CBG06205b		[unknown]
CDS:CBG06205a	CBG06205a		[unknown]
CDS:CBG06205d	CBG06205d		[unknown]
CDS:CBG06205c	CBG06205c		[unknown]

0 RNAi Result

19 Allele

• WBVar00006482
• WBVar00006472
• WBVar00006477
• WBVar00006462
• WBVar00006467
• WBVar00006452
• WBVar00006457
• WBVar00110998
• WBVar00111345
• WBVar00111346
• WBVar00111343
• WBVar00111344
• WBVar00111349
• WBVar00111347
• WBVar00111348
• WBVar00111341
• WBVar00111342
• WBVar00111340
• WBVar00111006

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057409
• Remark: Cbr-unc-22, GAAGGGAACCAACATTGTTTCTGTAGCTTCTTTGGTTGTCGTTGGAGAAAAAGCCGATCC, WBGene00028512
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region