WormMine: Gene WBGene00028705

• WormBase Gene ID: WBGene00028705
• Gene Name: Cbr-rga-4
• Sequence Name: CBG06428
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans rga-4. In C. elegans, rga-4 is involved in asymmetric protein localization involved in cell fate determination; cortical actin cytoskeleton organization; and regulation of actin filament-based process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06428b.1	CBG06428b.1		[unknown]
Transcript:CBG06428a.1	CBG06428a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06428b	CBG06428b		[unknown]
CDS:CBG06428a	CBG06428a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053108
• Remark: Cbr-rga-4, AGAAAGCTGTCAGTTGAGCCGCGCCCATCGGTAGCAATTATTCGAAGTAATAACTGCGGA, WBGene00028705
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region