WormMine: Gene WBGene00028908

• WormBase Gene ID: WBGene00028908
• Gene Name: Cbr-lin-40
• Sequence Name: CBG06664
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable chromatin binding activity and sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans lin-40.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06664b.1	CBG06664b.1		[unknown]
Transcript:CBG06664a.1	CBG06664a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06664b	CBG06664b		[unknown]
CDS:CBG06664a	CBG06664a		[unknown]

0 RNAi Result

13 Allele

• WBVar00111587
• WBVar00111588
• WBVar00111589
• WBVar00111590
• WBVar00111591
• WBVar00111592
• WBVar00052269
• WBVar00052274
• WBVar00020739
• WBVar00020744
• WBVar00020749
• WBVar00020754
• WBVar00020759

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1067898
• Remark: Cbr-lin-40, GCCCGTCATCCATGCGAATTCCATCAATTTCTTCAGTCATACCATGCAATAATATCTCCA, WBGene00028908
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region