WormMine: Gene WBGene00028989

• WormBase Gene ID: WBGene00028989
• Gene Name: Cbr-ceh-34
• Sequence Name: CBG06765
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans ceh-34. In C. elegans, ceh-34 is involved in mesodermal cell fate specification; positive regulation of apoptotic process involved in development; and regulation of DNA-templated transcription.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06765a.1	CBG06765a.1		[unknown]
Transcript:CBG06765b.1	CBG06765b.1		[unknown]
Transcript:CBG06765b.2	CBG06765b.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06765b	CBG06765b		[unknown]
CDS:CBG06765a	CBG06765a		[unknown]

0 RNAi Result

13 Allele

• WBVar00111720
• WBVar00111712
• WBVar00111713
• WBVar00111710
• WBVar00111711
• WBVar00111716
• WBVar00111717
• WBVar00111714
• WBVar00111715
• WBVar00111718
• WBVar00111719
• WBVar00111709
• WBVar00111708

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054546
• Remark: Cbr-ceh-34, TGCTTCGTGACGCCTACAAGAAAAATAACTATCCATCGGTGGATGAGAAGAAGAGGTTGG, WBGene00028989
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region