WormMine: Gene WBGene00029020

• WormBase Gene ID: WBGene00029020
• Gene Name: Cbr-dgk-3
• Sequence Name: CBG06804
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP-dependent diacylglycerol kinase activity and calcium ion binding activity. Predicted to be involved in protein kinase C-activating G protein-coupled receptor signaling pathway. Is an ortholog of C. elegans dgk-3. In C. elegans, dgk-3 is involved in olfactory behavior; regulation of long-term neuronal synaptic plasticity; and thermotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06804b.1	CBG06804b.1		[unknown]
Transcript:CBG06804a.1	CBG06804a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06804a	CBG06804a		[unknown]
CDS:CBG06804b	CBG06804b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057854
• Remark: Cbr-dgk-3, GATCTTGGACAAGACGCATCTCTCGAAGGTATCGCTCTTCTAAACATTCCATCAATTTAC, WBGene00029020
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region