Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG06809.1 | CBG06809.1 | [unknown] |
Other
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_upregulated | |
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Expr10979 | Cb-glp-1 mRNA is present throughout both the germline and embryo, but Cb-GLP-1 protein is present only in the mitotic region of the germline and only in the anterior blastomeres of the embryo. | |||
Cbr-glp-1, GAAGACTCCTATGATTCAAGAAACGAACCATTTGACGCCTCCACACTCGGATGGATCGTT, WBGene00029022 | Expr1065366 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
5 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
involved_in | |
involved_in | |
involved_in | |
located_in |