Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG06829.1 | CBG06829.1 | [unknown] |
Other
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-lin-12, AACTCCAATTATGTTGGCAGCTAGAGAAGGGCATTCAAGGACTGTCATGTTTTTGGTTCA, WBGene00029035 | Expr1065837 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CBG06829, CATTCAAGGACTGTCATGTTTTTGGTTCACAGTGGAGCAAGTATTGAAGCAGTCGATGCA, WBGene00029037 | Expr1054404 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |