WormMine: Gene WBGene00029061

• WormBase Gene ID: WBGene00029061
• Gene Name: Cbr-seb-2
• Sequence Name: CBG06860
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans seb-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06860.1	CBG06860.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06860	CBG06860		[unknown]

0 RNAi Result

20 Allele

• WBVar00006857
• WBVar00006767
• WBVar00006772
• WBVar00006762
• WBVar00006792
• WBVar00006797
• WBVar00006777
• WBVar00006782
• WBVar00006787
• WBVar00006802
• WBVar00006807
• WBVar00006847
• WBVar00006852
• WBVar00006832
• WBVar00006837
• WBVar00006842
• WBVar00006822
• WBVar00006827
• WBVar00006812
• WBVar00006817

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055459
• Remark: CBG06860, TCGTGTGTTATTCGAATAAAACCGTCCGTGAATGCTTCACGAAATGGCGTTCAACATATC, WBGene00029061
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region