WormMine: Gene WBGene00029076

• WormBase Gene ID: WBGene00029076
• Gene Name: Cbr-unc-32
• Sequence Name: CBG06881
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of vacuolar proton-transporting V-type ATPase, V0 domain. Is an ortholog of C. elegans unc-32. In C. elegans, unc-32 is involved in several processes, including cholinergic synaptic transmission; positive regulation of neurotransmitter secretion; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06881d.1	CBG06881d.1		[unknown]
Transcript:CBG06881c.1	CBG06881c.1		[unknown]
Transcript:CBG06881b.1	CBG06881b.1		[unknown]
Transcript:CBG06881a.1	CBG06881a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06881a	CBG06881a		[unknown]
CDS:CBG06881b	CBG06881b		[unknown]
CDS:CBG06881c	CBG06881c		[unknown]
CDS:CBG06881d	CBG06881d		[unknown]

0 RNAi Result

1 Allele

• WBVar00007029

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053530
• Remark: Cbr-unc-32, CTTATGGAAGGTCTCTCAGCGTTCCTTCACGCTCTTCGTCTTCATTGGCAAGCAAAAAAA, WBGene00029076
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region