WormMine: Gene WBGene00029201

• WormBase Gene ID: WBGene00029201
• Gene Name: Cbr-cat-2
• Sequence Name: CBG07026
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable iron ion binding activity and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen. Predicted to be involved in aromatic amino acid metabolic process. Is an ortholog of C. elegans cat-2. In C. elegans, cat-2 is involved in several processes, including cellular response to amphetamine; dopamine biosynthetic process from tyrosine; and male mating behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07026.1	CBG07026.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07026	CBG07026		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1070147
• Remark: Cbr-cat-2, AAATATGAAGACGATGATTATCAGCCGCTTTATTTTGTGGCTGATAGCATTCACGACGCT, WBGene00029201
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region