WormMine: Gene WBGene00029235

• WormBase Gene ID: WBGene00029235
• Gene Name: Cbr-nfyb-1
• Sequence Name: CBG07067
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription activator activity, RNA polymerase II-specific and protein heterodimerization activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be part of CCAAT-binding activity factor complex. Is an ortholog of C. elegans nfyb-1. In C. elegans, nfyb-1 is involved in negative regulation of transcription by RNA polymerase II and tissue development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07067.1	CBG07067.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07067	CBG07067		[unknown]

0 RNAi Result

2 Allele

• WBVar00014589
• WBVar00014584

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068675
• Remark: Cbr-nfyb-1, CAGTTCGAGAATGATCCACCAGTGCCGCCTCTCTTCTTCGAGACGCCAAATGGGAGAAGA, WBGene00029235
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region