WormMine: Gene WBGene00029260

• WormBase Gene ID: WBGene00029260
• Gene Name: CBG07097
• Sequence Name: CBG07097
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTPase activator activity. Predicted to be involved in regulation of small GTPase mediated signal transduction. Is an ortholog of C. elegans F53A10.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07097b.1	CBG07097b.1		[unknown]
Transcript:CBG07097a.1	CBG07097a.1		[unknown]
Transcript:CBG07097d.1	CBG07097d.1		[unknown]
Transcript:CBG07097c.1	CBG07097c.1		[unknown]
Transcript:CBG07097f.1	CBG07097f.1		[unknown]
Transcript:CBG07097e.1	CBG07097e.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07097a	CBG07097a		[unknown]
CDS:CBG07097b	CBG07097b		[unknown]
CDS:CBG07097e	CBG07097e		[unknown]
CDS:CBG07097f	CBG07097f		[unknown]
CDS:CBG07097c	CBG07097c		[unknown]
CDS:CBG07097d	CBG07097d		[unknown]

0 RNAi Result

20 Allele

• WBVar00046629
• WBVar00046624
• WBVar00046639
• WBVar00046634
• WBVar00046649
• WBVar00046644
• WBVar00111990
• WBVar00111991
• WBVar00111994
• WBVar00111995
• WBVar00111992
• WBVar00111993
• WBVar00111998
• WBVar00111996
• WBVar00111997
• WBVar00017054
• WBVar00017059
• WBVar00017064
• WBVar00017069
• WBVar00017074

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052452
• Remark: CBG07097, CGTCTGGAGACGTTATGTGTTGATGTTCAGCGTCTTCAAACTGAAAAATCAGATTTATTG, WBGene00029260
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region