WormMine: Gene WBGene00029397

• WormBase Gene ID: WBGene00029397
• Gene Name: Cbr-lgc-21
• Sequence Name: CBG07310
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable extracellular ligand-gated monoatomic ion channel activity and transmembrane signaling receptor activity. Predicted to be involved in monoatomic ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans lgc-21.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07310.1	CBG07310.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07310	CBG07310		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1056939
• Remark: Cbr-lgc-21, TATGATGAACAAGTAGCTCAAACTTCGTACCAGAAGGATTGGAACAACGTGTTCCGTGCC, WBGene00029397
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region