WormMine: Gene WBGene00029584

• WormBase Gene ID: WBGene00029584
• Gene Name: Cbr-tatn-1
• Sequence Name: CBG07591
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable L-tyrosine:2-oxoglutarate aminotransferase activity and pyridoxal phosphate binding activity. Predicted to be involved in aromatic amino acid metabolic process and biosynthetic process. Is an ortholog of C. elegans tatn-1. In C. elegans, tatn-1 is involved in dauer entry.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07591b.1	CBG07591b.1		[unknown]
Transcript:CBG07591a.1	CBG07591a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07591b	CBG07591b		[unknown]
CDS:CBG07591a	CBG07591a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053314
• Remark: Cbr-tatn-1, TCAAGCCAAAGGGAGCCATGTACATGATGGTCAACATCTCCAGATCTGCTTATGGAAATG, WBGene00029584
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region