Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG07632.1 | CBG07632.1 | [unknown] |
Other
9 Allele
Public Name |
---|
WBVar00112655 |
WBVar00112654 |
WBVar00112653 |
WBVar00112652 |
WBVar00112656 |
WBVar00112648 |
WBVar00112649 |
WBVar00112651 |
WBVar00112650 |
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated | |
C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG07632, AACTTCAATTCGTTGCTCAAGGAGGACCAACATGGGGAAAAGTTCCATCGTTCAAGTGGT, WBGene00029614 | Expr1054393 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |