WormMine: Gene WBGene00029644

• WormBase Gene ID: WBGene00029644
• Gene Name: Cbr-piki-1
• Sequence Name: CBG07670
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatidylinositol binding activity. Predicted to be involved in phosphatidylinositol phosphate biosynthetic process. Is an ortholog of C. elegans piki-1. In C. elegans, piki-1 is involved in several processes, including phagosome maturation involved in apoptotic cell clearance; phosphatidylinositol-3-phosphate biosynthetic process; and positive regulation of phagocytosis, engulfment.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07670.1	CBG07670.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07670	CBG07670		[unknown]

0 RNAi Result

3 Allele

• WBVar00008452
• WBVar00008447
• WBVar00112246

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069079
• Remark: Cbr-piki-1, ATGTCGTCAAGTTCGAGTTTCGCAAAGCAAGATCCACACAAGCTCAGCTTCGTTCCTGAA, WBGene00029644
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region