WormMine: Gene WBGene00029649

• WormBase Gene ID: WBGene00029649
• Gene Name: Cbr-ser-2
• Sequence Name: CBG07677
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable octopamine receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans ser-2. In C. elegans, ser-2 is involved in octopamine or tyramine signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07677a.1	CBG07677a.1		[unknown]
Transcript:CBG07677d.1	CBG07677d.1		[unknown]
Transcript:CBG07677c.1	CBG07677c.1		[unknown]
Transcript:CBG07677b.1	CBG07677b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07677d	CBG07677d		[unknown]
CDS:CBG07677c	CBG07677c		[unknown]
CDS:CBG07677b	CBG07677b		[unknown]
CDS:CBG07677a	CBG07677a		[unknown]

0 RNAi Result

13 Allele

• WBVar00112732
• WBVar00112731
• WBVar00112730
• WBVar00112735
• WBVar00112734
• WBVar00112733
• WBVar00112729
• WBVar00112728
• WBVar00112727
• WBVar00050524
• WBVar00050514
• WBVar00050519
• WBVar00050509

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061628
• Remark: Cbr-ser-2, CATTCCTTTATGGTATTCTGAATTTGGAGTTTCGAAGAGCATTCAAGAAGATTCTCTGCC, WBGene00029649
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region