WormMine: Gene WBGene00029682

• WormBase Gene ID: WBGene00029682
• Gene Name: Cbr-dyn-1
• Sequence Name: CBG07725
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Is an ortholog of C. elegans dyn-1. In C. elegans, dyn-1 is involved in several processes, including embryo development; endocytosis; and necroptotic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07725.1	CBG07725.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07725	CBG07725		[unknown]

0 RNAi Result

2 Allele

• WBVar00112769
• WBVar00019729

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055820
• Remark: Cbr-dyn-1, GAGCGTCAAGTGGAGACCATTCGTAATTTGGTCGACTCGTATATGAGAATCATCACCAAA, WBGene00029682
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region