WormMine: Gene WBGene00029684

• WormBase Gene ID: WBGene00029684
• Gene Name: Cbr-gas-1
• Sequence Name: CBG07730
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable NAD binding activity; oxidoreductase activity, acting on NAD(P)H; and quinone binding activity. Is an ortholog of C. elegans gas-1. In C. elegans, gas-1 is involved in mitochondrial electron transport, NADH to ubiquinone and response to xenobiotic stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07730a.1	CBG07730a.1		[unknown]
Transcript:CBG07730b.1	CBG07730b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07730b	CBG07730b		[unknown]
CDS:CBG07730a	CBG07730a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056178
• Remark: Cbr-gas-1, CCACCAAAGAGAGCTGAGATGAAGGAGAACATGGAGTCGCTCATTCATCACTTCAAGTTC, WBGene00029684
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region