WormMine: Gene WBGene00029794

• WormBase Gene ID: WBGene00029794
• Gene Name: Cbr-spds-1
• Sequence Name: CBG07888
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable catalytic activity. Predicted to be involved in polyamine metabolic process. Is an ortholog of C. elegans spds-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07888b.1	CBG07888b.1		[unknown]
Transcript:CBG07888a.1	CBG07888a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07888a	CBG07888a		[unknown]
CDS:CBG07888b	CBG07888b		[unknown]

0 RNAi Result

5 Allele

• WBVar00009062
• WBVar00009067
• WBVar00009052
• WBVar00009057
• WBVar00009047

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1050919
• Remark: CBG07888, CCTGCTCGTGTGCTCTCTGATGAACAAGTCAAGAATATGAATCTCAGATTCTATAATTCC, WBGene00029794
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region