Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG07915.1 | CBG07915.1 | [unknown] |
Other
17 Allele
Public Name |
---|
WBVar00046184 |
WBVar00046179 |
WBVar00046144 |
WBVar00046139 |
WBVar00046154 |
WBVar00046149 |
WBVar00046164 |
WBVar00046159 |
WBVar00046174 |
WBVar00046169 |
WBVar00046134 |
WBVar00046129 |
WBVar00112888 |
WBVar00112887 |
WBVar00016734 |
WBVar00016724 |
WBVar00016729 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG07915, AAACAGTCGAAAACTGTTCTTCTACTCGTTATTACACCTTCCATTGATCATGTTACTGAT, WBGene00029808 | Expr1052305 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |