WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029822 Gene Name  Cbr-gale-1
Sequence Name  ? CBG07935 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable UDP-glucose 4-epimerase activity. Predicted to be involved in galactose metabolic process. Is an ortholog of C. elegans gale-1. In C. elegans, gale-1 is involved in several processes, including gonad morphogenesis; negative regulation of endoplasmic reticulum unfolded protein response; and positive regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07935.1 CBG07935.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07935 CBG07935   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-eif-6, CGGCGAGCAAGGAGCACCAACGAGCATCAGCAATCAATTGAGAGATACACTCATCGAGAG, WBGene00029824   Expr1054901 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-gale-1, GGAGATGTGTGCGGATTTGTGGAATTGGCAAACGAAAAATCCACAGGGATTCTCGGCATA, WBGene00029822   Expr1056295 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region