WormMine: Gene WBGene00029838

• WormBase Gene ID: WBGene00029838
• Gene Name: CBG07952
• Sequence Name: CBG07952
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans Y53H1A.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07952a.1	CBG07952a.1		[unknown]
Transcript:CBG07952c.1	CBG07952c.1		[unknown]
Transcript:CBG07952b.1	CBG07952b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07952c	CBG07952c		[unknown]
CDS:CBG07952a	CBG07952a		[unknown]
CDS:CBG07952b	CBG07952b		[unknown]

0 RNAi Result

9 Allele

• WBVar00112901
• WBVar00112900
• WBVar00112905
• WBVar00112904
• WBVar00112903
• WBVar00112902
• WBVar00112899
• WBVar00112898
• WBVar00027704

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069827
• Remark: CBG07952, ATATGTTGGCATCAGAAGTCACAACGACTACGCTTCCAGAATCTTTAGAATCCCTGTTAT, WBGene00029838
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region