WormMine: Gene WBGene00029848

• WormBase Gene ID: WBGene00029848
• Gene Name: Cbr-hmr-1
• Sequence Name: CBG07964
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be involved in homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in membrane. Is an ortholog of C. elegans hmr-1. In C. elegans, hmr-1 is involved in cytoskeleton organization; embryo development; and gastrulation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07964.1	CBG07964.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07964	CBG07964		[unknown]

0 RNAi Result

13 Allele

• WBVar00000837
• WBVar00000835
• WBVar00000840
• WBVar00112952
• WBVar00112954
• WBVar00112953
• WBVar00027934
• WBVar00027904
• WBVar00027909
• WBVar00027914
• WBVar00027919
• WBVar00027924
• WBVar00027929

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061238
• Remark: Cbr-hmr-1, CACCGAAAGACGATATGGAGCTGAATTCGAAGATCAAGGACCTGGAATCGGATCAAAACG, WBGene00029848
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region