WormMine: Gene WBGene00029857

• WormBase Gene ID: WBGene00029857
• Gene Name: Cbr-mxt-1
• Sequence Name: CBG07980
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity and eukaryotic initiation factor 4E binding activity. Predicted to be involved in positive regulation of translation. Is an ortholog of C. elegans mxt-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07980.1	CBG07980.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07980	CBG07980		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058320
• Remark: CBG07980, GGCAGCAACTACTACAGTAGTTATGGCAACTGCAGTACCCGCTTCTCATGTGCAACAGCA, WBGene00029857
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region