WormMine: Gene WBGene00029910

• WormBase Gene ID: WBGene00029910
• Gene Name: Cbr-png-1
• Sequence Name: CBG08042
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in glycoprotein catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans png-1. In C. elegans, png-1 is involved in ERAD pathway; cell redox homeostasis; and negative regulation of collateral sprouting.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08042.1	CBG08042.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08042	CBG08042		[unknown]

0 RNAi Result

11 Allele

• WBVar00009762
• WBVar00009767
• WBVar00009747
• WBVar00009752
• WBVar00009757
• WBVar00009737
• WBVar00009742
• WBVar00009727
• WBVar00009732
• WBVar00009772
• WBVar00009777

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065782
• Remark: Cbr-png-1, ACAGATGTCACCTGGAGATATGTCTTTGATAGCAAGAAGCTGGTGACCCAAGAGAGAAAT, WBGene00029910
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region