WormMine: Gene WBGene00029925

• WormBase Gene ID: WBGene00029925
• Gene Name: Cbr-pdk-1.1
• Sequence Name: CBG08059
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans pdk-1. In C. elegans, pdk-1 is involved in several processes, including cellular response to reactive oxygen species; dauer larval development; and regulation of synaptic assembly at neuromuscular junction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08059a.1	CBG08059a.1		[unknown]
Transcript:CBG08059b.1	CBG08059b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08059a	CBG08059a		[unknown]
CDS:CBG08059b	CBG08059b		[unknown]

0 RNAi Result

1 Allele

• WBVar00009782

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059688
• Remark: Cbr-pdk-1, CTATTACTTGTTTGACCCAGAGAAAACTGCGGCCGAATGGTGCAAGGCAATTGAAGCTGT, WBGene00029925
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region