WormMine: Gene WBGene00029931

• WormBase Gene ID: WBGene00029931
• Gene Name: Cbr-unc-1
• Sequence Name: CBG08066
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in plasma membrane. Is an ortholog of C. elegans unc-1. In C. elegans, unc-1 is involved in positive regulation of cell communication by electrical coupling and response to xenobiotic stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08066c.1	CBG08066c.1		[unknown]
Transcript:CBG08066a.1	CBG08066a.1		[unknown]
Transcript:CBG08066b.1	CBG08066b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08066a	CBG08066a		[unknown]
CDS:CBG08066b	CBG08066b		[unknown]
CDS:CBG08066c	CBG08066c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063596
• Remark: Cbr-unc-1, AACAGAAAGCGTCGCGCGCTCTCAAAGAAGCAGCTGATGTCATTCAAGCCAATCCGGTGG, WBGene00029931
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region