WormMine: Gene WBGene00029944

• WormBase Gene ID: WBGene00029944
• Gene Name: Cbr-vps-45
• Sequence Name: CBG08081
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in vesicle-mediated transport. Is an ortholog of C. elegans vps-45. In C. elegans, vps-45 is involved in pinocytosis and receptor-mediated endocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08081.1	CBG08081.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08081	CBG08081		[unknown]

0 RNAi Result

3 Allele

• WBVar00136809
• WBVar00136811
• WBVar00136810

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052758
• Remark: Cbr-vps-45, TAGTGATCGAACGTTTTCAAGACATTGCAACGCCGCTACTCAACCAATGGACTTATGAAG, WBGene00029944
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region