WormMine: Gene WBGene00029948

• WormBase Gene ID: WBGene00029948
• Gene Name: Cbr-arr-1
• Sequence Name: CBG08085
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans arr-1. In C. elegans, arr-1 is involved in positive regulation of growth rate.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08085b.1	CBG08085b.1		[unknown]
Transcript:CBG08085a.1	CBG08085a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08085a	CBG08085a		[unknown]
CDS:CBG08085b	CBG08085b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068034
• Remark: Cbr-arr-1, ATAAGCGATGCTACTAATGGCTCCGACCCTCAAGATATTGATCTCATTCAACTACACGAA, WBGene00029948
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region