WormMine: Gene WBGene00029955

• WormBase Gene ID: WBGene00029955
• Gene Name: Cbr-sel-12
• Sequence Name: CBG08092
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable aspartic endopeptidase activity, intramembrane cleaving. Predicted to be involved in egg-laying behavior; nervous system development; and protein processing. Predicted to be located in membrane. Is an ortholog of C. elegans sel-12. In C. elegans, sel-12 is involved in several processes, including apical protein localization; egg-laying behavior; and regulation of signal transduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08092a.1	CBG08092a.1		[unknown]
Transcript:CBG08092b.1	CBG08092b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08092a	CBG08092a		[unknown]
CDS:CBG08092b	CBG08092b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067535
• Remark: Cbr-sel-12, AATTTCCATATTCTCCGGTTTGATTTTCTATTTCTGTACTCGTTGGATTATCACCCCATT, WBGene00029955
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region