WormMine: Gene WBGene00029982

• WormBase Gene ID: WBGene00029982
• Gene Name: Cbr-npr-19
• Sequence Name: CBG08123
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans npr-19.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08123a.1	CBG08123a.1		[unknown]
Transcript:CBG08123b.1	CBG08123b.1		[unknown]
Transcript:CBG08123c.1	CBG08123c.1		[unknown]
Transcript:CBG08123d.1	CBG08123d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08123a	CBG08123a		[unknown]
CDS:CBG08123c	CBG08123c		[unknown]
CDS:CBG08123b	CBG08123b		[unknown]
CDS:CBG08123d	CBG08123d		[unknown]

0 RNAi Result

2 Allele

• WBVar00042019
• WBVar00113071

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066397
• Remark: CBG08123, AACACACAACTTAGACGAGAATTACACTATTTGATATGCCGACACCACGTAATTTCGACG, WBGene00029982
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region