WormMine: Gene WBGene00030001

• WormBase Gene ID: WBGene00030001
• Gene Name: Cbr-mrp-1
• Sequence Name: CBG08145
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans mrp-1. In C. elegans, mrp-1 is involved in dauer larval development; regulatory ncRNA-mediated post-transcriptional gene silencing; and stress response to metal ion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08145a.1	CBG08145a.1		[unknown]
Transcript:CBG08145b.1	CBG08145b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08145a	CBG08145a		[unknown]
CDS:CBG08145b	CBG08145b		[unknown]

0 RNAi Result

9 Allele

• WBVar00136823
• WBVar00113135
• WBVar00113139
• WBVar00113138
• WBVar00113137
• WBVar00113136
• WBVar00113141
• WBVar00113140
• WBVar00013464

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050969
• Remark: Cbr-mrp-1, TTTGTTCCGAATCATCGAGGCAGATGGCGGATGTATAGAAATTGATGGTGTGAATATAGC, WBGene00030001
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region