WormMine: Gene WBGene00030002

• WormBase Gene ID: WBGene00030002
• Gene Name: Cbr-mrp-2
• Sequence Name: CBG08146
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity; ATP binding activity; and ATP hydrolysis activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans mrp-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08146b.1	CBG08146b.1		[unknown]
Transcript:CBG08146a.1	CBG08146a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08146b	CBG08146b		[unknown]
CDS:CBG08146a	CBG08146a		[unknown]

0 RNAi Result

2 Allele

• WBVar00009817
• WBVar00009812

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1058060
• Remark: Cbr-mrp-2, CTAACATTAGCGTTGTTTCGAATTATTGAAGCCGATGGTGGATGTATTGAAATTGATGGA, WBGene00030002
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region