WormMine: Gene WBGene00030012

• WormBase Gene ID: WBGene00030012
• Gene Name: Cbr-egl-17
• Sequence Name: CBG08160
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable growth factor activity. Is an ortholog of C. elegans egl-17. In C. elegans, egl-17 is involved in regulation of cell migration and regulation of egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08160.1	CBG08160.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08160	CBG08160		[unknown]

0 RNAi Result

2 Allele

• WBVar00013469
• WBVar00013474

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058083
• Remark: Cbr-egl-17, AACCTCGATGTTTTGATTGGATCAAACTGGTACGGTATGTACCTGAATCTGAGAAAAATG, WBGene00030012
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00041118

0 Upstream Intergenic Region