WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030071 Gene Name  Cbr-rbg-2
Sequence Name  ? CBG08238 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Rab3 GTPase-activating protein regulatory subunit N-terminus; Rab3-GAP regulatory subunit, N-terminal; Rab3GAP regulatory subunit, C-terminal; Rab3 GTPase-activating protein regulatory subunit C-terminus; and Rab3GAP regulatory subunit. Is an ortholog of C. elegans rbg-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08238.1 CBG08238.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08238 CBG08238   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-rbg-2, AAGAAGCAGTGTCGTCACTTGGTAAAGCAGGAAATTCGGTGCCACAATCAGCGCAGGCCG, WBGene00030071   Expr1052519 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region