WormMine: Gene WBGene00030090

• WormBase Gene ID: WBGene00030090
• Gene Name: Cbr-suro-1
• Sequence Name: CBG08265
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metallocarboxypeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans suro-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08265.1	CBG08265.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08265	CBG08265		[unknown]

0 RNAi Result

3 Allele

• WBVar00113284
• WBVar00113283
• WBVar00113282

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065407
• Remark: CBG08265, ACTGGGCTAAATCGGCTCTCGCTGTAAAATATGTCTACCTAATTGAACTCCGTCCACAAA, WBGene00030090
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region