WormMine: Gene WBGene00030124

• WormBase Gene ID: WBGene00030124
• Gene Name: Cbr-cha-1
• Sequence Name: CBG08307
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable acyltransferase activity and xenobiotic transmembrane transporter activity. Predicted to be involved in transmembrane transport and xenobiotic transport. Predicted to be located in membrane. Is an ortholog of C. elegans cha-1. In C. elegans, cha-1 is involved in acetylcholine biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08307c.1	CBG08307c.1		[unknown]
Transcript:CBG08307b.1	CBG08307b.1		[unknown]
Transcript:CBG08307a.1	CBG08307a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08307a	CBG08307a		[unknown]
CDS:CBG08307b	CBG08307b		[unknown]
CDS:CBG08307c	CBG08307c		[unknown]

0 RNAi Result

32 Allele

• WBVar00113369
• WBVar00113368
• WBVar00113367
• WBVar00113373
• WBVar00113372
• WBVar00113371
• WBVar00113370
• WBVar00113377
• WBVar00113376
• WBVar00113375
• WBVar00113374
• WBVar00113366
• WBVar00113365
• WBVar00113364
• WBVar00113363
• WBVar00113389
• WBVar00113391
• WBVar00113390
• WBVar00113394
• WBVar00113393
• WBVar00113392
• WBVar00113379
• WBVar00113378
• WBVar00113380
• WBVar00113384
• WBVar00113383
• WBVar00113382
• WBVar00113381
• WBVar00113388
• WBVar00113387

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1062584
• Remark: Cbr-cha-1, ATCGGAGAACTGATTTGACTCATTTTAAGAAGAGTTTGGGAGATGCGATGAGAGATGTAA, WBGene00030122
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1068998
• Remark: CBG08307, CACTAATTGGGGATTCACTGCTCTTAACATCATTATCTTTATCACCAACGTTGGATATGC, WBGene00030124
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region