WormMine: Gene WBGene00030137

• WormBase Gene ID: WBGene00030137
• Gene Name: Cbr-taf-6.2
• Sequence Name: CBG08324
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA polymerase II general transcription initiation factor activity and protein heterodimerization activity. Predicted to be involved in transcription initiation at RNA polymerase II promoter. Predicted to be part of SAGA complex; SLIK (SAGA-like) complex; and transcription factor TFIID complex. Is an ortholog of C. elegans taf-6.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08324.1	CBG08324.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08324	CBG08324		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062893
• Remark: Cbr-taf-6.2, GAGAGAGCATCTTAAGTCAATCGATCTACGCATCCAGAACTTCTGAACCATTGGCGAAGA, WBGene00030137
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region