WormMine: Gene WBGene00030186

• WormBase Gene ID: WBGene00030186
• Gene Name: Cbr-mec-3
• Sequence Name: CBG08386
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans mec-3. In C. elegans, mec-3 is involved in several processes, including mechanosensory behavior; neuron projection organization; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08386b.1	CBG08386b.1		[unknown]
Transcript:CBG08386a.1	CBG08386a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08386a	CBG08386a		[unknown]
CDS:CBG08386b	CBG08386b		[unknown]

0 RNAi Result

9 Allele

• WBVar00009912
• WBVar00009917
• WBVar00009922
• WBVar00009902
• WBVar00009907
• WBVar00009927
• WBVar00009932
• WBVar00009892
• WBVar00009897

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061023
• Remark: Cbr-mec-3, AGAGGCGGCTGAAACATTTGTGCAATTATTTGAGACACTATGAGCAGAGAGGACTGATTC, WBGene00030186
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region