WormMine: Gene WBGene00030202

• WormBase Gene ID: WBGene00030202
• Gene Name: Cbr-cmk-1
• Sequence Name: CBG08406
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans cmk-1. In C. elegans, cmk-1 is involved in several processes, including neuron projection morphogenesis; positive regulation of transcription by RNA polymerase II; and thermosensory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08406.1	CBG08406.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08406	CBG08406		[unknown]

0 RNAi Result

17 Allele

• WBVar00113579
• WBVar00113578
• WBVar00113577
• WBVar00113576
• WBVar00113580
• WBVar00113568
• WBVar00113567
• WBVar00113566
• WBVar00113565
• WBVar00113569
• WBVar00113571
• WBVar00113570
• WBVar00113575
• WBVar00113574
• WBVar00113573
• WBVar00113572
• WBVar00113564

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056603
• Remark: Cbr-cmk-1, AACACCGCCTACACTCATGACATCCACAGAACTGTCGCAGTGCATCTTAAGAAAAGTTTG, WBGene00030202
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region