WormMine: Gene WBGene00030206

• WormBase Gene ID: WBGene00030206
• Gene Name: Cbr-snn-1
• Sequence Name: CBG08411
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity. Predicted to be involved in neurotransmitter secretion. Predicted to be located in synaptic vesicle. Is an ortholog of C. elegans snn-1. In C. elegans, snn-1 is involved in neuromuscular synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08411.1	CBG08411.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08411	CBG08411		[unknown]

0 RNAi Result

3 Allele

• WBVar00009947
• WBVar00009952
• WBVar00009942

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060720
• Remark: Cbr-snn-1, TGCTGGAACAGATTGCCACATGTGAGAGACACAAAAAGTACTTGAAGGCGATTACGGACC, WBGene00030206
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region