WormMine: Gene WBGene00030393

• WormBase Gene ID: WBGene00030393
• Gene Name: Cbr-ncx-9
• Sequence Name: CBG08637
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans ncx-9. In C. elegans, ncx-9 is involved in calcium export from the mitochondrion and regulation of dorsal/ventral axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08637.1	CBG08637.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08637	CBG08637		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057188
• Remark: Cbr-ncx-9, AAAAGAGATTGAACTTCTGATCAATCCAGTCTACCGTATCCTTCTTCTATTCCTGGGAAT, WBGene00030393
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region