WormMine: Gene WBGene00030403

• WormBase Gene ID: WBGene00030403
• Gene Name: Cbr-swt-7
• Sequence Name: CBG08648
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans swt-7. In C. elegans, swt-7 is involved in defense response to Gram-negative bacterium and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08648.1	CBG08648.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08648	CBG08648		[unknown]

0 RNAi Result

1 Allele

• WBVar00113873

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061590
• Remark: CBG08648, TATCCACCACTCACATGGACCGTTCCAATTTTCAACATTCCTCCACAGAAACAAGACAAT, WBGene00030403
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region